This protocol was adapted from Ma H et al, NBT, 2016. Hanhui Ma @ UMMS.
A. Design sgRNA oligos
Fwd: ACCGNNNNNNNNNNNNNNNNNN
Rev: AAACNNNNNNNNNNNNNNNNNN
B. Annealing oligos
*Reagents:
100 mM oligos and Annealing buffer
| Stock | ml | |
|---|---|---|
| 100 mM Tris-HCl pH8.0 | 1M | 0.25 |
| 50 mM NaCl | 5M | 0.25 |
| 1 mM EDTA | 0.5M | 0.05 |
| ddH2O | 24.5 | |
| Total | 25 |
*Annealing:
| μ | |
|---|---|
| Annealing buffer | 40 |
| Fwd oligo (100 μM) | 5 |
| Rev oligo (100 μM) | 5 |
| Total | 50 |
Incubate at 95 ℃ for 3 min and slowly cool down to room temperature;
Dilute 5 μl of annealed oligos to 245 μl water and final concentration is 200 nM (about
3ng/μl, ready for use).
C. Cloning annealed oligos into vectors
Reagents:
- pLH-sgRNA1 vectors*
- Enzymes and Buffer in reaction
- Stbl3 competent cells
- LB-Ampicillin plates
Reaction mix:
| μ | |
|---|---|
| pLH-sgRNA1 vector (100 ng/μl | 1 |
| 10XSmartCut Buffer (NEB) | 1 |
| 10 mM ATP (NEB) | 1 |
| BbsI (NEB) | 0.5 |
| T7 DNA ligase (NEB) | 0.3 |
| ddH2O | 5.2 |
| Annealed oligos (200 nM) | 1 |
| Total | 10 |
Incubate @ 37 ℃ for 15 min;
Transform 5 μl of reaction mix into Stbl3 competent cells and spread on LB-Amp plates.
D. Minipreps and Sequencing
Reagents:
- QIAprep Spin Miniprep Kit
- Sequencing primer pLKO.1-Rseq: CTATTCTTTCCCCTGCACTGTACCC
*Notes of pLH-sgRNA1 vectors:
sgRNA1 carried a pair of mutations described as sgRNAplus in Supplementary Figure 1, Ma H et al, NBT, 2016. All the sgRNA vector plasmids require CcdB Survival cells for growth